ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80.

Huynh, M. H., Carruthers, V. B. (2009 Apr, Eukaryot Cell)

As with other organisms with a completed genome sequence, opportunities for performing large-scale studies, such as expression and localization, on Toxoplasma gondii are now much more feasible. We present a system for tagging genes endogenously with yellow fluorescent protein (YFP) in a Deltaku80 strain. Ku80 is involved in DNA strand repair and nonhomologous DNA end joining; previous studies in other organisms have shown that in its absence, random integration is eliminated, allowing the insertion of constructs with homologous sequences into the proper loci. We generated a vector consisting of YFP and a dihydrofolate reductase-thymidylate synthase selectable marker. The YFP is preceded by a ligation-independent cloning (LIC) cassette, which allows the insertion of PCR products containing complementary LIC sequences. We demonstrated that the Deltaku80 strain is more effective and efficient in integrating the YFP-tagged constructs into the correct locus than wild-type strain RH. We then selected several hypothetical proteins that were identified by a proteomic screen of excreted-secreted antigens and that displayed microarray expression profiles similar to known micronemal proteins, with the thought that these could potentially be new proteins with roles in cell invasion. We localized these hypothetical proteins by YFP fluorescence and showed expression by immunoblotting. Our findings demonstrate that the combination of the Deltaku80 strain and the pYFP.LIC constructs reduces both the time and cost required to determine localization of a new gene of interest. This should allow the opportunity for performing larger-scale studies of novel T. gondii genes.

PubMed: 19218426, full text

Localisation information

TGME49_064080 (ACP) acyl carrier protein

Experimental localisation: apicoplast
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Positive control genes ACP (apicoplast), pCNA (nucleus), MIC3 (micronemes), and ROP1 (rhoptries) were cloned into the YFP expression vector and transfected into parasites, and localization was visualized by immunofluorescence with a GFP antibody."
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Apicoplast

TGME49_047460 (pCNA, PCNA1) proliferating cell nuclear antigen 1

Experimental localisation: nucleus
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Positive control genes ACP (apicoplast), pCNA (nucleus), MIC3 (micronemes), and ROP1 (rhoptries) were cloned into the YFP expression vector and transfected into parasites, and localization was visualized by immunofluorescence with a GFP antibody."
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Nucleus

TGME49_109590 (ROP1) rhoptry protein, putative

Experimental localisation: rhoptry
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Positive control genes ACP (apicoplast), pCNA (nucleus), MIC3 (micronemes), and ROP1 (rhoptries) were cloned into the YFP expression vector and transfected into parasites, and localization was visualized by immunofluorescence with a GFP antibody."
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Rhoptries

TGME49_119560 (MIC3, MIC 3) microneme protein MIC3

Experimental localisation: microneme
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Positive control genes ACP (apicoplast), pCNA (nucleus), MIC3 (micronemes), and ROP1 (rhoptries) were cloned into the YFP expression vector and transfected into parasites, and localization was visualized by immunofluorescence with a GFP antibody."
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Micronemes

TGME49_004130 (PLP1) membrane-attack complex / perforin domain-containing protein

Experimental localisation: microneme
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "YFP-tagged genes by immunofluorescence. (i) Microneme protein PLP1."
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Micronemes

TGME49_077080 (MIC5) microneme TgMIC5 protein

Experimental localisation: microneme
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Micronemes

TGME49_014940 (M2AP, proTgM2AP) MIC2-associated protein M2AP

Experimental localisation: microneme
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Micronemes

TGME49_047550 (Hsp60, HSP60) heat shock protein 60

Experimental localisation: mitochondrion
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: mitochondria

TGME49_031640 (IMC1, ALV1, IMC, NET1) membrane skeletal protein IMC1

Experimental localisation: inner membrane complex
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: IMC

TGME49_033460 (SAG1, SRS29B, P30/SAG1, BSR4, P30) SRS29B (= SAG1, P30)

Experimental localisation: parasite plasma membrane
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Surface

TGME49_121530 (CPL) cathepsin L-like thiolproteinase, putative

Experimental localisation: multi-vesicular endosome, lysosome
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Multi-vesicular endosome and lysosome

TGME49_093770 chitinase class I, putative

Experimental localisation: microneme
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Micronemes

TGME49_093900 (SPATR) hypothetical protein

Experimental localisation: microneme
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Micronemes

TGME49_004340 hypothetical protein

Experimental localisation: microneme
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Micronemes

TGME49_006510 (TLN4) peptidase M16 domain containing protein

Experimental localisation: sub-apical
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Sub-apical

TGME49_043930 hypothetical protein

Experimental localisation: sub-apical
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Sub-apical

TGME49_060190 microneme protein, putative

Experimental localisation: sub-apical
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Sub-apical

No assigned gene identifier (PRX, PRX1, 49.m03355, OPN, Der1-2ER, Der1Ap, RNG1)

Experimental localisation: conoid
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426, no gene matching in ToxoDB 5.2, blast from primers TACTTCCAATCCAATTTAATGCAGCCTGGGATTCAGGTGTAAATGTTC and TCCTCCACTTCCAATTTTAGCCGCCAGGTAGTAGACAGGTGGAGGGC not successful
  • Localisation record: tip/conoid

TGME49_080380 non-transmembrane antigen

Experimental localisation: parasitophorous vacuole
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "The 72.m00001 gene is annotated as a 62-kDa poly(ADP-ribose) glycohydrolase (PARG) family protein. YFP tagging of this protein showed localization in the parasitophorous vacuole and, in particular, an overlap with the intravacuolar membranous nanotubular network (42), as revealed by colocalization with the dense granule protein GRA2"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: PV

TGME49_002830 C2 domain-containing protein

Experimental localisation: cytosol
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Cytosolic

TGME49_049670 (tgcp1, toxopain-1, CP1, cathepsin B, CPB) cysteine proteinase, putative

Experimental localisation: rhoptry
  • Species: Toxoplasma gondii
  • Quote inferring localisation: "Table 1"
  • Microscopy type: Light
  • Microscopy method: YFP tag
  • Strain: RHKu80-
  • Gene model mapping comments: taken directly from 19218426
  • Localisation record: Rhoptries