ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

TGME49_093900 (SPATR)

hypothetical protein, a gene from Toxoplasma gondii

Compiled localisation
apical and microneme and parasite plasma membrane during extracellular tachyzoite
during not intracellular tachyzoite
not parasite plasma membrane during intracellular tachyzoite

Who localised this protein by microscopy?

Kawase, O., Nishikawa, Y., Bannai, H., Igarashi, M., Matsuo, T., Xuan, X.
Characterization of a novel thrombospondin-related protein in Toxoplasma gondii. (2010 Jun, Parasitol Int) PubMed / full text
   more detail about this publication

apical and microneme and parasite plasma membrane during extracellular tachyzoite, during not intracellular tachyzoite, not parasite plasma membrane during intracellular tachyzoite
  • "Additionally, IEM analysis demonstrated that TgSPATR was localized in the slightly dense structures of the parasite apical end, which must be micronemes because they were clearly distinguished from rhoptries and looked quite similar to micronemes shown in previous reports (Fig. 2f) [9,12]."
  • Microscopy type: EM
  • Microscopy method: antibody
  • Strain: RH
  • Gene model mapping comments: blast from primer CCATGGAGGTTTCAAGAAGTCACCGGT, 534 length matches, taken directly from publication
  • Localisation record: microneme during extracellular tachyzoite
  • Other genes localised in this publication: microneme protein 2
  • "We cloned a secreted protein with an altered thrombospondin repeat of Toxoplasma gondii (TgSPATR), which was the homologue of Plasmodium SPATRs. Immunofluorescence double staining experiment revealed that TgSPATR was co-localized with a microneme protein, MIC2, and immuno-electron microscopic (IEM) analysis detected TgSPATR in the microneme-like structure."
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain: RH
  • Gene model mapping comments: inferred from another publication
  • Localisation record: apical during extracellular tachyzoite, not during intracellular tachyzoite
  • Other genes localised in this publication: microneme protein 2
  • "Furthermore, TgSPATR, existed on outer surface of the parasites, was detected by incomplete membrane permeabilization by saponin and immunofluorescent antibody test (IFAT). Both TgSPATR and MIC2 were detected on outer surface of extracellular parasites, but not of intracellular single parasites, suggesting they were similarly secreted during early stages of parasite invasion."
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain: RH
  • Gene model mapping comments: inferred from another publication
  • Localisation record: not surface during intracellular tachyzoite, surface during extracellular tachyzoite
  • Other genes localised in this publication: microneme protein 2



Part of OrthoMCL group OG4_38860

Localised Genes in this Group
Other Apicomplexan Genes in this Group
  • PBANKA_030950 secreted protein with altered thrombospondin repeat domain, putative
  • PY02991 putative secreted protein with altered thrombospondin domain
  • PVX_002900 hypothetical protein, conserved
  • PCHAS_031160 secreted protein with altered thrombospondin repeat domain, putative
  • NCLIV_000860 SPATR, related
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>TGME49_093900 hypothetical protein

Gene-Specific Links for TGME49_093900

General Sub-Cellular Localisation Links

  • TargetP, prediction of signal peptides, as well as chloroplast and mitochondrial transit peptides
  • OrthoMCL, automatic clustering of orthologous groups of proteins