ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

TGME49_018850 (S9, rps9)

ribosomal protein S9, putative, a gene from Toxoplasma gondii

Compiled localisation
apicoplast during tachyzoite

Who localised this protein by microscopy?

Yung, S., Unnasch, T. R., Lang-Unnasch, N.
Analysis of apicoplast targeting and transit peptide processing in Toxoplasma gondii by deletional and insertional mutagenesis. (2001 Nov, Mol Biochem Parasitol) PubMed / full text
   more detail about this publication

  • "Deletion analysis demonstrated that the first 55 amino acids of the rps9 leader were sufficient for apicoplast targeting."
  • Microscopy type: Light
  • Microscopy method: GFP tag, HA tag
  • Strain: RH hxgprt-
  • Gene model mapping comments: annotation matches, blast from primer ATGCATATGGCCCTCGAACGTTGGTG
  • Localisation record: apicoplast
  • Other genes localised in this publication: heat shock protein 70, putative

DeRocher, A., Hagen, C. B., Froehlich, J. E., Feagin, J. E., Parsons, M.
Analysis of targeting sequences demonstrates that trafficking to the Toxoplasma gondii plastid branches off the secretory system. (2000 Nov, J Cell Sci) PubMed / full text
   more detail about this publication

apicoplast during tachyzoite
  • "The first 159 aa of S9 and the first 143 aa of L28 also efficiently targeted GFP to the apicoplast"
  • Microscopy type: Light
  • Microscopy method: GFP tag
  • Strain: RH
  • Gene model mapping comments: Blast from AF087139 from 11058084
  • Localisation record: apicoplast during tachyzoites
  • Other genes localised in this publication: 50S ribosomal protein L28, putative, acyl carrier protein

Waller, R. F., Keeling, P. J., Donald, R. G., Striepen, B., Handman, E., Lang-Unnasch, N., Cowman, A. F., Besra, G. S., Roos, D. S., McFadden, G. I.
Nuclear-encoded proteins target to the plastid in Toxoplasma gondii and Plasmodium falciparum. (1998 Oct 13, Proc Natl Acad Sci U S A) PubMed / full text
   more detail about this publication

apicoplast during tachyzoite
  • "Immunodetection of S9 and ACP (respectively) in intact T. gondii cells demonstrates that these proteins are restricted to a distinct region of the parasite similar to the location of the apicoplast. "
  • Microscopy type: Light
  • Microscopy method: antibody directly to protein
  • Strain: RH
  • Gene model mapping comments: inferred from another publication
  • Localisation record: apicoplast during tachyzoite
  • Other genes localised in this publication: acyl carrier protein



Part of OrthoMCL group OG4_10926

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>TGME49_018850 ribosomal protein S9, putative

Gene-Specific Links for TGME49_018850

General Sub-Cellular Localisation Links

  • TargetP, prediction of signal peptides, as well as chloroplast and mitochondrial transit peptides
  • OrthoMCL, automatic clustering of orthologous groups of proteins