ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PY07092 (TRSP)

hypothetical protein, a gene from Plasmodium yoelii

Compiled localisation
apical and not surface during salivary gland sporozoite

Who localised this protein by microscopy?

Kaiser, K., Matuschewski, K., Camargo, N., Ross, J., Kappe, S. H.
Differential transcriptome profiling identifies Plasmodium genes encoding pre-erythrocytic stage-specific proteins. (2004 Mar, Mol Microbiol) PubMed / full text
   more detail about this publication

apical and not surface during salivary gland sporozoite
  • "A. Dual indirect immunofluorescence assay (IFA) on salivary gland sporozoites with antiserum specific for PyTRAP, a sporozoite micronemal protein, and with antiserum specific for PyTRSP. TRAP staining is internal and not restricted to one pole of the sporozoite. TRSP has a different distribution, showing an internal, bilobed staining pattern that extends from the nuclear region to the apical end of the sporozoite where the two lobes seemingly converge. B. Dual IFA on oocyst sporozoites with antiserum specific for PyCSP, a sporozoite surface protein, and with antiserum specific for PyTRSP. TRSP localization is distinct from the surface-localized CSP."
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain: 17XNL
  • Gene model mapping comments: blast from primers GATGGACAGAATGGTCGCAGT and tttagaacagagtaatgaataaatagggttactac
  • Localisation record: apical and not surface during salivary gland sporozoite
  • Other genes localised in this publication: sporozoite surface protein 2 precursor, circumsporozoite protein, hypothetical protein, early transcribed membrane protein family



Part of OrthoMCL group OG4_47550

Localised Genes in this Group
Other Apicomplexan Genes in this Group
  • PFA0200w thrombospondin-related sporozoite protein
  • PBANKA_020910 thrombospondin related sporozoite protein
  • PVX_081560 hypothetical protein, conserved
  • PCHAS_020750 thrombospondin related sporozoite protein, putative
  • PKH_020930 conserved Plasmodium protein, unknown function
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>PY07092 hypothetical protein


Found in:

Not found in:

Gene-Specific Links for PY07092

General Sub-Cellular Localisation Links