ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PY04764 (EBL)

duffy receptor, beta form precursor, a gene from Plasmodium yoelii

Compiled localisation
dense granule during individual merozoites and schizont and segmented schizont
apical during individual merozoites and segmented schizont
microneme during individual merozoites and segmented schizont

Who localised this protein by microscopy?

Ogun, S. A., Tewari, R., Otto, T. D., Howell, S. A., Knuepfer, E., Cunningham, D. A., Xu, Z., Pain, A., Holder, A. A.
Targeted disruption of py235ebp-1: invasion of erythrocytes by Plasmodium yoelii using an alternative Py235 erythrocyte binding protein. (2011 Feb, PLoS Pathog) PubMed / full text
   more detail about this publication

dense granule during schizont
  • "The pattern of reactivity (Figure 3B) was similar but not identical to that of antibodies specific for the micronemal protein, Apical Membrane Antigen 1 (AMA1) [39], the erythrocyte binding ligand protein (EBL), which has a dense granule location in this parasite line [40], and rhoptry neck protein 4 (RON 4) [41]."
  • Microscopy type: Light
  • Microscopy method: Polyclonal antibody
  • Strain: YM
  • Gene model mapping comments: inferred from another publication
  • Localisation record: dense granule during schizont
  • Other genes localised in this publication: rhoptry protein, apical membrane antigen-1, Drosophila melanogaster CG15040 gene product

Otsuki, H., Kaneko, O., Thongkukiatkul, A., Tachibana, M., Iriko, H., Takeo, S., Tsuboi, T., Torii, M.
Single amino acid substitution in Plasmodium yoelii erythrocyte ligand determines its localization and controls parasite virulence. (2009 Apr 28, Proc Natl Acad Sci U S A) PubMed / full text
   more detail about this publication

apical during individual merozoites and segmented schizont, dense granule and microneme during individual merozoites and segmented schizont
  • "EBL Localizes in the Dense Granules in P. yoelii Line 17XL. "
  • Microscopy type: Fixed Light
  • Microscopy method: polyclonal antibody
  • Strain: 17XL
  • Gene model mapping comments: blast from southern blot probe TAAATCTAAATGGGATACAT, anntoation matches, blast from primer gagaCTCGAGGTTAATTTATTAAAAAGAACATATGAATCTTTCC
  • Localisation record: Diffused but granular apical during segmented schizont-stage and individual merozoites
  • Comment: Strain-specific localisation observed
  • Other genes localised in this publication: apical membrane antigen-1
  • "In the 17XL line, however, PyEBL localized not in the microneme but in another microorganelle—the dense granules (12) (Fig. 2C and Fig. S4). "
  • Microscopy type: EM
  • Microscopy method: polyclonal antibody
  • Strain: 17XL
  • Gene model mapping comments: inferred from another publication
  • Localisation record: dense granule during segmented schizont-stage and individual merozoites
  • Other genes localised in this publication: apical membrane antigen-1
  • "In the 17X line, PyEBL localized to the apical end of each merozoite in both the segmented schizont-stage parasite and individual merozoites, where it colocalized with AMA1, a known microneme protein, under immunofluorescent microscopy (Fig. 2B)."
  • Microscopy type: Fixed Light
  • Microscopy method: polyclonal antibody
  • Strain: 17X
  • Gene model mapping comments: inferred from another publication
  • Localisation record: apical during segmented schizont-stage and individual merozoites
  • Other genes localised in this publication: apical membrane antigen-1
  • "Immunoelectron microscopy revealed that PyEBL localized in micronemes in the 17X line as reported for P. falciparum and Plasmodium knowlesi (10, 11). "
  • Microscopy type: EM
  • Microscopy method: polyclonal antibody
  • Strain: 17X
  • Gene model mapping comments: inferred from another publication
  • Localisation record: microneme during segmented schizont-stage and individual merozoites
  • Other genes localised in this publication: apical membrane antigen-1
  • "Diffused localization of PyEBL was also observed in parasites of the YM line (Fig. S3). "
  • Microscopy type: Fixed Light
  • Microscopy method: polyclonal antibody
  • Strain: YM
  • Gene model mapping comments: inferred from another publication
  • Localisation record: Diffused but granular apical during segmented schizont-stage and individual merozoites
  • Other genes localised in this publication: apical membrane antigen-1



Part of OrthoMCL group OG4_31615

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>PY04764 duffy receptor, beta form precursor


Found in:

Not found in:

Gene-Specific Links for PY04764

General Sub-Cellular Localisation Links