ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFL1915w (GyrB)

DNA gyrase subunit B, a gene from Plasmodium falciparum

Compiled localisation
apicoplast during intraerythrocytic

Who localised this protein by microscopy?

Dar, A., Prusty, D., Mondal, N., Dhar, S. K.
A unique 45-amino-acid region in the toprim domain of Plasmodium falciparum gyrase B is essential for its activity. (2009 Nov, Eukaryot Cell) PubMed / full text
   more detail about this publication

  • "These results strongly suggest that PfGyrB binds specifically to the apicoplast DNA compared to the nuclear DNA in vivo."
  • Microscopy type: ChIP
  • Microscopy method:
  • Strain:
  • Gene model mapping comments: blast from primer CTAGCTAGCTATAATTATGATGCTAAAGATATTG, annotation matches
  • Localisation record: apicoplast
  • Other genes localised in this publication: -

Dar, M. A., Sharma, A., Mondal, N., Dhar, S. K.
Molecular cloning of apicoplast-targeted Plasmodium falciparum DNA gyrase genes: unique intrinsic ATPase activity and ATP-independent dimerization of PfGyrB subunit. (2007 Mar, Eukaryot Cell) PubMed / full text
   more detail about this publication

apicoplast during intraerythrocytic
  • "In panels 1and 2, PfACP (green) and PfGyrB (red) are colocalized to the apicoplast."
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody directly to protein
  • Strain: 3D7
  • Gene model mapping comments: Taken directly from paper, The deduced sequences perfectly matched the sequences reported in the database (see Fig. S1A and B in the supplemental material).
  • Localisation record: apicoplast during asexual
  • Other genes localised in this publication: acyl carrier protein, DNA gyrase subunit A



Part of OrthoMCL group OG4_12159

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PFL1915w DNA gyrase subunit B

Gene-Specific Links for PFL1915w

General Sub-Cellular Localisation Links