ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFL1550w (mLipDH)

lipoamide dehydrogenase, a gene from Plasmodium falciparum

Compiled localisation
mitochondrion during intraerythrocytic and ring and schizont and trophozoite
not apicoplast during ring and schizont and trophozoite

Who localised this protein by microscopy?

McMillan, P. J., Stimmler, L. M., Foth, B. J., McFadden, G. I., Muller, S.
The human malaria parasite Plasmodium falciparum possesses two distinct dihydrolipoamide dehydrogenases. (2005 Jan, Mol Microbiol) PubMed / full text
   more detail about this publication

mitochondrion and not apicoplast during ring and schizont and trophozoite
  • "Colocalization experiments with the apicoplast protein ACP (C) and with the two mitochondrial markers MitoTracker Red and HSP60 (D and E) indicate that mLipDH is localized exclusively in the mitochondrion."
  • Microscopy type: Light
  • Microscopy method: GFP tag after first 33 amino acids
  • Strain: D10
  • Gene model mapping comments: Blast from primer GCGCCATATGTCAACTAAGAAAGACTATGATGTTATAGTCATTGG and GGATCCTTACATGTGTATAGGTTTATC, annotation matches
  • Localisation record: Mitochondria and not apicoplast during ring and troph and schizont
  • Other genes localised in this publication: lipoamide dehydrogenase, acyl carrier protein, heat shock protein 60

Gunther, S., McMillan, P. J., Wallace, L. J., Muller, S.
Plasmodium falciparum possesses organelle-specific alpha-keto acid dehydrogenase complexes and lipoylation pathways. (2005 Nov, Biochem Soc Trans) PubMed / full text
   more detail about this publication

mitochondrion during intraerythrocytic
  • "The localization of the E1b-subunit of P. falciparum BCKDH complex and the mitochondrial lipoamide dehydrogenase were analysed by expressing the first 390 and 653 nucleotides respectively tagged with GFP in erythrocytic stages of the parasite."
  • Microscopy type: Light
  • Microscopy method: GFP tag after 653 nucleotides
  • Strain:
  • Gene model mapping comments: inferred from another publication
  • Localisation record: Mitochondria during asexual
  • Comment: strain information not found
  • Other genes localised in this publication: 3-methyl-2-oxobutanoate dehydrogenase (lipoamide), putative



Part of OrthoMCL group OG4_10422

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PFL1550w lipoamide dehydrogenase

Gene-Specific Links for PFL1550w

General Sub-Cellular Localisation Links