ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFL1465c (HslV)

heat shock protein hslv, a gene from Plasmodium falciparum

Compiled localisation
cytosol during ring and schizont and trophozoite
during not ring
mitochondrial matrix and mitochondrion and not mitochondrial membrane

Who localised this protein by microscopy?

Tschan, S., Kreidenweiss, A., Stierhof, Y. D., Sessler, N., Fendel, R., Mordmuller, B.
Mitochondrial localization of the threonine peptidase PfHslV, a ClpQ ortholog in Plasmodium falciparum. (2010 Nov, Int J Parasitol) PubMed / full text
   more detail about this publication

mitochondrial matrix and mitochondrion and not mitochondrial membrane
  • "Both findings led us to conclude that PfHslV-EYFP is located in the plasmodial mitochondrion."
  • Microscopy type: Light
  • Microscopy method: C terminal EFYP tag, EYFP tag after 37 residues
  • Strain: D10
  • Gene model mapping comments: inferred from another publication
  • Localisation record: mitochondrion
  • Comment: stage information not found
  • Other genes localised in this publication: acyl carrier protein
  • "PfHslV-EYFP localization was further investigated by immunoelectron microscopy showing that it is localized to the matrix, surrounded by the mitochondrial double membrane (Fig. 3)."
  • Microscopy type: EM
  • Microscopy method: antibody to GFP tag
  • Strain: D10
  • Gene model mapping comments: inferred from another publication
  • Localisation record: mitochondrial matrix and not mitochondrial membrane
  • Comment: stage information not found
  • Other genes localised in this publication: acyl carrier protein

Ramasamy, G., Gupta, D., Mohmmed, A., Chauhan, V. S.
Characterization and localization of Plasmodium falciparum homolog of prokaryotic ClpQ/HslV protease. (2007 Apr, Mol Biochem Parasitol) PubMed / full text
   more detail about this publication

cytosol during ring and schizont and trophozoite, during not ring
  • "To localize PfHslV in the parasite, an IFA was carried out using specific anti-PfHslV antibodies. In both trophozoite and schizont stages, fluorescence was distributed specifically in the parasite cytoplasm (Fig. 2B) and no fluorescence was observed using pre-immune sera"
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody directly to protein
  • Strain: 3D7
  • Gene model mapping comments: Blast from primer TGAGAAGTTGTGTTGAGTTAGC, annotation doesn't match, amino acid sequence agrees with figure
  • Localisation record: Cytosol during troph and schizont, not during ring
  • Other genes localised in this publication: -
  • "The protein was localized in the cytosol of the parasite as a soluble protein by Western immunoblotting of parasite fractions and by immuno-fluorescence microscopy."
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody directly to protein
  • Strain: 3D7
  • Gene model mapping comments: Taken directly from 16616382, annotation matches
  • Localisation record: Cytosol during ring and troph and schizont
  • Other genes localised in this publication: -



Part of OrthoMCL group OG4_13750

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>PFL1465c heat shock protein hslv

Gene-Specific Links for PFL1465c

General Sub-Cellular Localisation Links