ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)


porphobilinogen deaminase, a gene from Plasmodium falciparum

Compiled localisation
apicoplast and not mitochondrion during schizont and trophozoite

Who localised this protein by microscopy?

Nagaraj, V. A., Arumugam, R., Prasad, D., Rangarajan, P. N., Padmanaban, G.
Protoporphyrinogen IX oxidase from Plasmodium falciparum is anaerobic and is localized to the mitochondrion. (2010 Nov, Mol Biochem Parasitol) PubMed / full text
   more detail about this publication

  • ""
  • Microscopy type: Fixed Light
  • Microscopy method: Immunofluorescence data presented in Fig. 5 indicate that PfPPO colocalizes with PfHSP60, a mitochondrial marker, but not with PfPBGD, an apicoplast marker, establishing that PfPPO is a mitochondrial enzyme
  • Strain:
  • Gene model mapping comments: inferred from another publication
  • Localisation record: mitochondrion
  • Comment: strain information not found
  • Comment: stage information not found in publication
  • Other genes localised in this publication: protoporphyrinogen oxidase, heat shock protein 60

Nagaraj, V. A., Prasad, D., Rangarajan, P. N., Padmanaban, G.
Mitochondrial localization of functional ferrochelatase from Plasmodium falciparum. (2009 Nov, Mol Biochem Parasitol) PubMed / full text
   more detail about this publication

apicoplast and not mitochondrion
  • "PfFC clearly co-localizes with PfHSP60 (mitochondrial marker) and not with PfPBGD (apicoplast marker)."
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain:
  • Gene model mapping comments: inferred from another publication
  • Localisation record: apicoplast and not mitochondria
  • Other genes localised in this publication: ferrochelatase, heat shock protein 60

Nagaraj, V. A., Arumugam, R., Chandra, N. R., Prasad, D., Rangarajan, P. N., Padmanaban, G.
Localisation of Plasmodium falciparum uroporphyrinogen III decarboxylase of the heme-biosynthetic pathway in the apicoplast and characterisation of its catalytic properties. (2009 Apr, Int J Parasitol) PubMed / full text
   more detail about this publication

apicoplast and not mitochondrion
  • "A similar approach was used recently to localise PfPBGD to the apicoplast "
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain:
  • Gene model mapping comments: inferred from another publication
  • Localisation record: apicoplast and not mitochondria
  • Comment: strain information not found
  • Comment: stage information not found in publication
  • Other genes localised in this publication: uroporphyrinogen III decarboxylase, heat shock protein 60

Nagaraj, V. A., Arumugam, R., Gopalakrishnan, B., Jyothsna, Y. S., Rangarajan, P. N., Padmanaban, G.
Unique properties of Plasmodium falciparum porphobilinogen deaminase. (2008 Jan 4, J Biol Chem) PubMed / full text
   more detail about this publication

apicoplast and not mitochondrion during schizont and trophozoite
  • "The results presented in Fig. 8 indicate that PfPBGD colocalizes with PfALAD but not with PfALAS, establishing that the native enzyme is localized to the apicoplast in the parasite."
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody directly to protein
  • Strain:
  • Gene model mapping comments: Taken directly from paper, blast from primer GACCGGATCCGGGAACTCGTGATTCTCCG
  • Localisation record: Apicoplast and not mitochondria during troph and schizont
  • Comment: strain information not found
  • Other genes localised in this publication: delta-aminolevulinic acid dehydratase, delta-aminolevulinic acid synthetase

Sato, S., Clough, B., Coates, L., Wilson, R. J.
Enzymes for heme biosynthesis are found in both the mitochondrion and plastid of the malaria parasite Plasmodium falciparum. (2004 Mar, Protist) PubMed / full text
   more detail about this publication

apicoplast and not mitochondrion during schizont and trophozoite



Part of OrthoMCL group OG4_10837

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PFL0480w porphobilinogen deaminase

Gene-Specific Links for PFL0480w

General Sub-Cellular Localisation Links