ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFL0150w (Orc1, ORC1)

origin recognition complex subunit 1, a gene from Plasmodium falciparum

Compiled localisation
nucleus during gametocyte stage iii-iv and ring and schizont and trophozoite
cytoplasm and not cytosol and not nucleus during schizont and trophozoite
replication foci in nucleus during ring and trophozoite
during not ring and not schizont

Who localised this protein by microscopy?

Gupta, A., Mehra, P., Deshmukh, A., Dar, A., Mitra, P., Roy, N., Dhar, S. K.
Functional dissection of the catalytic carboxyl-terminal domain of origin recognition complex subunit 1 (PfORC1) of the human malaria parasite Plasmodium falciparum. (2009 Sep, Eukaryot Cell) PubMed / full text
   more detail about this publication

nucleus during schizont and trophozoite
  • "Interestingly, both PfORC1 and PfPCNA foci 14 mostly co-localize with each other during replicating trophozoite stage confirming co15 immunoprecipitation data as described above (fig. 4D, rows 1-3). During late multi16 nuclei schizont stage (where the individual nucleus has separated from each other 17 following DNA replication, fig.4D, rows 4-5), although bright PfPCNA signals are still 18 visible, PfORC1 signal is very weak and no distinct co-localization pattern between these 19 proteins can be detected in contrast to the trophozoite stage."
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody directly to protein
  • Strain: 3D7
  • Gene model mapping comments: inferred from another publication
  • Localisation record: nuclear during troph and schizont
  • Other genes localised in this publication: proliferating cell nuclear antigen

Mancio-Silva, L., Rojas-Meza, A. P., Vargas, M., Scherf, A., Hernandez-Rivas, R.
Differential association of Orc1 and Sir2 proteins to telomeric domains in Plasmodium falciparum. (2008 Jun 15, J Cell Sci) PubMed / full text
   more detail about this publication

nucleus during ring, cytoplasm and not nucleus during schizont and trophozoite
  • "Here, we identified, in P. falciparum, a novel telomere-associated protein that displays homology with the origin-of-recognition-complex 1 protein Orc1. Antibodies raised against this P. falciparum protein localized to telomeric clusters in the nuclear periphery and the nucleolus. Double-labelling IF studies revealed that, as the parasite differentiates, there is an increase in Sir2 and Orc1 protein levels together with their relocalization to a non-nuclear region (Fig. 4B-D). Strikingly, the IF pattern changes from well-defined perinuclear spots in ring stages to rather diffuse small dots in trophozoite stages."
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain:
  • Gene model mapping comments: inferred from another publication
  • Localisation record: Nucleolus and Telomeric Foci during ring, cytoplasm and not nucleus during troph and schizont
  • Comment: strain information not found
  • Other genes localised in this publication: transcriptional regulatory protein sir2a, fibrillarin, putative

Gupta, A., Mehra, P., Dhar, S. K.
Plasmodium falciparum origin recognition complex subunit 5: functional characterization and role in DNA replication foci formation. (2008 Aug, Mol Microbiol) PubMed / full text
   more detail about this publication

replication foci in nucleus during ring and trophozoite, during not schizont
  • "PfORC1, another member of the ORC colocalizes with PfORC5 and PfPCNA but gets degraded at the late schizont stage"
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody directly to protein
  • Strain: 3D7
  • Gene model mapping comments: inferred from another publication
  • Localisation record: replication foci in nucleus during ring and troph, not during schizont
  • Other genes localised in this publication: proliferating cell nuclear antigen, origin recognition complex subunit 5

Gupta, A., Mehra, P., Nitharwal, R., Sharma, A., Biswas, A. K., Dhar, S. K.
Analogous expression pattern of Plasmodium falciparum replication initiation proteins PfMCM4 and PfORC1 during the asexual and sexual stages of intraerythrocytic developmental cycle. (2006 Aug, FEMS Microbiol Lett) PubMed / full text
   more detail about this publication

nucleus during gametocyte stage iii-iv and schizont and trophozoite, not cytosol during schizont and trophozoite, during not ring
  • "PfORC1 was also confined to the nucleus during the schizont stage οΎ… PfORC1 showed strong nuclear staining that perfectly overlapped with the DAPI staining apart from some diffused staining in the cytoplasm."
  • Microscopy type: Fixed Light
  • Microscopy method: antibody
  • Strain: 3D7
  • Gene model mapping comments: inferred from another publication
  • Localisation record: nucleus and not cytosol during trophozoite and schizont, not during ring, nucleus during stage III-IV gametocyte
  • Other genes localised in this publication: minchromosome maintenance (MCM) complex subunit, putative, nucleosome assembly protein

Mehra, P., Biswas, A. K., Gupta, A., Gourinath, S., Chitnis, C. E., Dhar, S. K.
Expression and characterization of human malaria parasite Plasmodium falciparum origin recognition complex subunit 1. (2005 Nov 25, Biochem Biophys Res Commun) PubMed / full text
   more detail about this publication

nucleus during schizont and trophozoite, during not ring
  • "Immune sera gave discrete localization of gold particles only in the parasite nuclei and very rarely in the cytoplasm, suggesting that PfORC1 is specifically located in the nucleus (Figs. 4AC)."
  • Microscopy type: Light, EM
  • Microscopy method: polyclonal antibody directly to protein
  • Strain: 3D7
  • Gene model mapping comments: blast from primer CGGGATCCATGACTCCTAAGAAAAAAATATTT, annotation matches
  • Localisation record: nucleus during troph and schizont, not during ring
  • Other genes localised in this publication: -



Part of OrthoMCL group OG4_10295

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PFL0150w origin recognition complex subunit 1

Gene-Specific Links for PFL0150w

General Sub-Cellular Localisation Links