ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFF0895w (MDH)

malate dehydrogenase, a gene from Plasmodium falciparum

Compiled localisation
cytosol during intraerythrocytic

Who localised this protein by microscopy?

Pradhan, A., Mukherjee, P., Tripathi, A. K., Avery, M. A., Walker, L. A., Tekwani, B. L.
Analysis of quaternary structure of a [LDH-like] malate dehydrogenase of Plasmodium falciparum with oligomeric mutants. (2009 May, Mol Cell Biochem) PubMed / full text
   more detail about this publication

cytosol during intraerythrocytic
  • "The enzyme is localized primarily in the parasites cytosol."
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain: D6
  • Gene model mapping comments: Blast from primer GGACTTAATGGTACCCTTACAAGCATATACATCGGTAAATGGTGTTC, annotation matches
  • Localisation record: cytosol during asexual
  • Other genes localised in this publication: -



Part of OrthoMCL group OG4_10365

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PFF0895w malate dehydrogenase

Gene-Specific Links for PFF0895w

General Sub-Cellular Localisation Links