ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFE0225w (BCKDH E1b)

3-methyl-2-oxobutanoate dehydrogenase (lipoamide), putative, a gene from Plasmodium falciparum

Compiled localisation
mitochondrion during intraerythrocytic

Who localised this protein by microscopy?

Gunther, S., McMillan, P. J., Wallace, L. J., Muller, S.
Plasmodium falciparum possesses organelle-specific alpha-keto acid dehydrogenase complexes and lipoylation pathways. (2005 Nov, Biochem Soc Trans) PubMed / full text
   more detail about this publication

mitochondrion during intraerythrocytic
  • "The localization of the E1b-subunit of P. falciparum BCKDH complex and the mitochondrial lipoamide dehydrogenase were analysed by expressing the first 390 and 653 nucleotides respectively tagged with GFP in erythrocytic stages of the parasite."
  • Microscopy type: Light
  • Microscopy method: GFP tag after 390 nucleotides
  • Strain:
  • Gene model mapping comments: Blast from primer GCGCCATATGATGAGACTATTAAGAAATAACG from 15612914, annotation matches
  • Localisation record: Mitochondria during asexual
  • Comment: strain information not found
  • Other genes localised in this publication: lipoamide dehydrogenase



Part of OrthoMCL group OG4_11646

Localised Genes in this Group
Other Apicomplexan Genes in this Group
  • PBANKA_110420 3-methyl-2-oxobutanoate dehydrogenase (lipoamide), putative
  • PY03843 Drosophila melanogaster RE25729p
  • PVX_097790 3-methyl-2-oxobutanoate dehydrogenase (lipoamide), putative
  • PCHAS_110390 3-methyl-2-oxobutanoate dehydrogenase (lipoamide), putative
  • PKH_102840 3-methyl-2-oxobutanoate dehydrogenase (lipoamide), putative
  • TGME49_114400 branched-chain alpha-keto acid dehydrogenase E1 component beta chain, putative
  • NCLIV_057460 Transketolase central region, related
  • TP01_0956 pyruvate dehydrogenase E1 component beta subunit, mitochondrial, putative
  • TA06600 transketolase subunit, putative
  • BBOV_IV008190 branched-chain alpha-keto acid dehydrogenase E1 component beta subunit, putative
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>PFE0225w 3-methyl-2-oxobutanoate dehydrogenase (lipoamide), putative

Gene-Specific Links for PFE0225w

General Sub-Cellular Localisation Links