ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFD1120c (ETRAMP4, SEP4, Etramp 4, Etramp4)

early transcribed membrane protein 4, a gene from Plasmodium falciparum

Compiled localisation
parasitophorous vacuole during ring and schizont
parasitophorous vacuole membrane during ring
not erythrocyte plasma membrane and not parasite plasma membrane during ring
during not schizont
erythrocyte cytoplasmic vesicle during ring and trophozoite
erythrocyte cytosol during schizont

Who localised this protein by microscopy?

Luah, Y. H., Chaal, B. K., Ong, E. Z., Bozdech, Z.
A moonlighting function of Plasmodium falciparum histone 3, mono-methylated at lysine 9? (2010, PLoS One) PubMed / full text
   more detail about this publication

parasitophorous vacuole during schizont

Spielmann, T., Gardiner, D. L., Beck, H. P., Trenholme, K. R., Kemp, D. J.
Organization of ETRAMPs and EXP-1 at the parasite-host cell interface of malaria parasites. (2006 Feb, Mol Microbiol) PubMed / full text
   more detail about this publication

parasitophorous vacuole membrane during ring
  • "C and D. Immunofluorescence analysis in acetone-fixed IRBCs: the tagged transgenes detected via the myc tag colocalize with the respective chromosomally derived ETRAMPs in a typical peripheral staining in the transfected parasites D10E2myc (C) and D10E4myc (D)."
  • Microscopy type: Light
  • Microscopy method: myc tag, polyclonal antibody directly to protein
  • Strain: D10
  • Gene model mapping comments: inferred from another publication
  • Localisation record: PVM during ring
  • Other genes localised in this publication: early transcribed membrane protein 2, early transcribed membrane protein 10.1

Spielmann, T., Hawthorne, P. L., Dixon, M. W., Hannemann, M., Klotz, K., Kemp, D. J., Klonis, N., Tilley, L., Trenholme, K. R., Gardiner, D. L.
A cluster of ring stage-specific genes linked to a locus implicated in cytoadherence in Plasmodium falciparum codes for PEXEL-negative and PEXEL-positive proteins exported into the host cell. (2006 Aug, Mol Biol Cell) PubMed / full text
   more detail about this publication

parasitophorous vacuole during ring
  • "We then used transgenic 3D7 and D10 parasites expressing a myc-tagged ETRAMP4, a marker for the parasite PVM that can be detected by commercial rabbit anti-myc serum (Spielmann et al., 2006 )."
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody to myc tag and protein
  • Strain: 3D7
  • Gene model mapping comments: inferred from another publication
  • Localisation record: PV during ring
  • Other genes localised in this publication: ring-exported protein 2, ring-exported protein 3, ring-exported protein 4

Birago, C., Albanesi, V., Silvestrini, F., Picci, L., Pizzi, E., Alano, P., Pace, T., Ponzi, M.
A gene-family encoding small exported proteins is conserved across Plasmodium genus. (2003 Feb, Mol Biochem Parasitol) PubMed / full text
   more detail about this publication

erythrocyte cytoplasmic vesicle during ring and trophozoite, erythrocyte cytosol during schizont
  • "The three immune sera gave a similar pattern of fluorescence: at the ring and the trophozoite stages vesicle-like structures were detected within the erythrocytic compartment; with the progression of schizogony the specific-fluorescence appeared more diffuse and the association with vesicles less evident."
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain: 3D7
  • Gene model mapping comments: Taken directly from publication, blast from primer GCATGAACGTTTTCGTTCCAGGA
  • Localisation record: Erythrocyte Cytoplasmic Vesicles during ring and troph, erythrocyte cytosol during schizont
  • Other genes localised in this publication: early transcribed membrane protein 14.1, early transcribed membrane protein 11.2, early transcribed membrane protein

Spielmann, T., Fergusen, D. J., Beck, H. P.
etramps, a new Plasmodium falciparum gene family coding for developmentally regulated and highly charged membrane proteins located at the parasite-host cell interface. (2003 Apr, Mol Biol Cell) PubMed / full text
   more detail about this publication

parasitophorous vacuole membrane and not erythrocyte plasma membrane and not parasite plasma membrane during ring, during not schizont



Part of OrthoMCL group OG4_64898

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>PFD1120c early transcribed membrane protein 4

Gene-Specific Links for PFD1120c

General Sub-Cellular Localisation Links