ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PFB0345c (SERA4, SERA3)

serine repeat antigen 4, a gene from Plasmodium falciparum

Compiled localisation
parasitophorous vacuole during late schizont and schizont and trophozoite

Who localised this protein by microscopy?

Miller, S. K., Good, R. T., Drew, D. R., Delorenzi, M., Sanders, P. R., Hodder, A. N., Speed, T. P., Cowman, A. F., de Koning-Ward, T. F., Crabb, B. S.
A subset of Plasmodium falciparum SERA genes are expressed and appear to play an important role in the erythrocytic cycle. (2002 Dec 6, J Biol Chem) PubMed / full text
   more detail about this publication

parasitophorous vacuole during late schizont
  • "Both SERA5 and SERA6 are known to localize to the parasitophorous vacuole (1, 2, 23). Double labeling experiments revealed that SERA4 co-localizes with SERA5 (Fig. 7A). Consistent with parasitophorous vacuole staining, fluorescence was limited to the parasite but excluded from the merozoite, giving a "channeled" appearance in segmented schizonts. Furthermore, SERA4 also appeared to co-localize with the membrane-anchored merozoite surface protein 1(MSP-1) in mature (segmented) schizonts, also consistent with a parasitophorous vacuole location for SERA4 (Fig. 7B)."
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody directly to protein
  • Strain: D10
  • Gene model mapping comments: blast from primer ACTCGAGTTATCATCAGAATTAGCACCAC, annotation matches
  • Localisation record: PV during segmented schizont
  • Other genes localised in this publication: serine repeat antigen 5, merozoite surface protein 1

Aoki, S., Li, J., Itagaki, S., Okech, B. A., Egwang, T. G., Matsuoka, H., Palacpac, N. M., Mitamura, T., Horii, T.
Serine repeat antigen (SERA5) is predominantly expressed among the SERA multigene family of Plasmodium falciparum, and the acquired antibody titers correlate with serum inhibition of the parasite growth. (2002 Dec 6, J Biol Chem) PubMed / full text
   more detail about this publication

parasitophorous vacuole during schizont and trophozoite
  • "They appeared to be similarly localized as SERA5 protein in the parasitophorous vacuole."
  • Microscopy type: Fixed light
  • Microscopy method: antibody
  • Strain: Honduras-1
  • Gene model mapping comments: Taken directly from publication
  • Localisation record: parasitophorous vacuole during trophozoite and schizont
  • Other genes localised in this publication: serine repeat antigen 5, serine repeat antigen 6



Part of OrthoMCL group OG4_14937

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>PFB0345c serine repeat antigen 4

Gene-Specific Links for PFB0345c

General Sub-Cellular Localisation Links