ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PF13_0095 (MCM4)

minchromosome maintenance (MCM) complex subunit, putative, a gene from Plasmodium falciparum

Compiled localisation
nucleus during gametocyte stage iii-iv and schizont and trophozoite
not cytosol during schizont and trophozoite
during not ring
cytoplasm during gametocyte stage iii-iv

Who localised this protein by microscopy?

Gupta, A., Mehra, P., Nitharwal, R., Sharma, A., Biswas, A. K., Dhar, S. K.
Analogous expression pattern of Plasmodium falciparum replication initiation proteins PfMCM4 and PfORC1 during the asexual and sexual stages of intraerythrocytic developmental cycle. (2006 Aug, FEMS Microbiol Lett) PubMed / full text
   more detail about this publication

nucleus during gametocyte stage iii-iv and schizont and trophozoite, not cytosol during schizont and trophozoite, during not ring, cytoplasm during gametocyte stage iii-iv
  • "The expression of PfMCM4 was confined to the nucleus as the DAPI-stained images completely merged with ALEXA green fluorescence. οΎ… Interestingly, PfMCM4 showed a distinct punctate staining all over the gametocyte although the nuclear signal was more intense than the cytoplasmic signal (Fig. 2b)."
  • Microscopy type: Fixed Light
  • Microscopy method: antibody
  • Strain: 3D7
  • Gene model mapping comments: blast from primer CGGAATTCATGGGTACACCAAGAAGAAG, annotation matches
  • Localisation record: nucleus and not cytosol during trophozoite and schizont, not during ring, nucleus and cytoplasm during stage III-IV gametocyte
  • Other genes localised in this publication: origin recognition complex subunit 1, nucleosome assembly protein



Part of OrthoMCL group OG4_11050

Localised Genes in this Group
Other Apicomplexan Genes in this Group
  • PBANKA_141560 minchromosome maintenance (MCM) complex subunit, putative
  • PY03411 DNA replication licensing factor MCM4-related
  • PVX_122675 DNA replication licensing factor MCM4, putative
  • PCHAS_141740 minchromosome maintenance (MCM) complex subunit, putative
  • PKH_141630 minchromosome maintenance (MCM) complex subunit, putative
  • TGME49_019700 DNA replication licensing factor, putative
  • NCLIV_060910 DNA replication licensing factor, putative
  • cgd2_1250 DNA replication licensing factor MCM4 like AAA+ ATpase
  • Chro.20137 DNA replication licensing factor
  • CMU_009090 cell division control protein 54, putative
  • TA17345 cell division control protein, putative
  • BBOV_II005160 DNA replication licensing factor MCM4
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PF13_0095 minchromosome maintenance (MCM) complex subunit, putative

Gene-Specific Links for PF13_0095

General Sub-Cellular Localisation Links