ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PF10_0218 (CS, CSP, citrate synthase)

citrate synthase, mitochondrial precursor, putative, a gene from Plasmodium falciparum

Compiled localisation
mitochondrion during intraerythrocytic and ring and schizont and trophozoite

Who localised this protein by microscopy?

Rotmann, A., Sanchez, C., Guiguemde, A., Rohrbach, P., Dave, A., Bakouh, N., Planelles, G., Lanzer, M.
PfCHA is a mitochondrial divalent cation/H+ antiporter in Plasmodium falciparum. (2010 Jun, Mol Microbiol) PubMed / full text
   more detail about this publication

mitochondrion during trophozoite
  • "Colocalization of PfCHA with the mitochondrial protein citrate synthase"
  • Microscopy type: Live light
  • Microscopy method: YFP tag
  • Strain: 3D7
  • Gene model mapping comments: inferred from another publication
  • Localisation record: Mitochondria during trophozoite
  • Other genes localised in this publication: cation/H antiporter

Maeda, T., Saito, T., Harb, O. S., Roos, D. S., Takeo, S., Suzuki, H., Tsuboi, T., Takeuchi, T., Asai, T.
Pyruvate kinase type-II isozyme in Plasmodium falciparum localizes to the apicoplast. (2009 Mar, Parasitol Int) PubMed / full text
   more detail about this publication

mitochondrion during intraerythrocytic
  • "To determine if PfPyKII localizes to the mitochondria, we analysed the immunolocalization of PfPyKII in a P. falciparum cell line expressing the citrate synthase fused to GFP, which targets to the mitochondria [7] (Fig. 3B)."
  • Microscopy type: Light
  • Microscopy method: GFP tag
  • Strain:
  • Gene model mapping comments: inferred from another publication
  • Localisation record: Mitochondria during asexual
  • Comment: strain information not found
  • Other genes localised in this publication: pyruvate kinase 2, putative

Tonkin, C. J., van Dooren, G. G., Spurck, T. P., Struck, N. S., Good, R. T., Handman, E., Cowman, A. F., McFadden, G. I.
Localization of organellar proteins in Plasmodium falciparum using a novel set of transfection vectors and a new immunofluorescence fixation method. (2004 Sep, Mol Biochem Parasitol) PubMed / full text
   more detail about this publication

mitochondrion during ring and schizont and trophozoite
  • "MitoTracker, a dye that specifically labels mitochondria, co-localized with the GFP at all stages (Fig. 2E and F), confirming that CS(l)-GFP is localized to the mitochondria."
  • Microscopy type: Light
  • Microscopy method: GFP
  • Strain: D10
  • Gene model mapping comments: Blast from primer AAAATGGAAGGAATAAGATACCTATCATGC, annotation matches
  • Localisation record: Mitochondria during ring and troph and schizont
  • Comment: This is citrate synthase, NOT circumsporozoite protein
  • Other genes localised in this publication: peptidyl deformylase, 4-diphosphocytidyl-2c-methyl-D-erythritol kinase (CMK), putative, acyl carrier protein, heat shock protein 60



Part of OrthoMCL group OG4_11071

Localised Genes in this Group
Other Apicomplexan Genes in this Group
  • PBANKA_050670 citrate synthase, mitochondrial precursor, putative
  • PY01660 probable citrate synthase, mitochondrial precursor
  • PVX_111595 citrate synthase, mitochondrial precursor, putative
  • PVX_228290 citrate synthase, mitochondrial precursor, putative
  • PCHAS_050680 citrate synthase, mitochondrial precursor, putative
  • PKH_060660 citrate synthase, mitochondrial precursor, putative
  • NCLIV_037460 hypothetical protein
  • TP02_0666 citrate synthase, putative
  • TA14450 citrate synthase, mitochondrial precursor, putative
  • BBOV_II006920 citrate synthase
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PF10_0218 citrate synthase, mitochondrial precursor, putative

Gene-Specific Links for PF10_0218

General Sub-Cellular Localisation Links