ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PF10_0168-a (GRASP2)

golgi re-assembly stacking protein 2, a gene from Plasmodium falciparum

Compiled localisation
golgi apparatus during extracellular merozoite and ring and schizont and trophozoite

Who localised this protein by microscopy?

Struck, N. S., Herrmann, S., Langer, C., Krueger, A., Foth, B. J., Engelberg, K., Cabrera, A. L., Haase, S., Treeck, M., Marti, M., Cowman, A. F., Spielmann, T., Gilberger, T. W.
Plasmodium falciparum possesses two GRASP proteins that are differentially targeted to the Golgi complex via a higher- and lower-eukaryote-like mechanism. (2008 Jul 1, J Cell Sci) PubMed / full text
   more detail about this publication

golgi apparatus during extracellular merozoite and ring and schizont and trophozoite
  • "GRASP2 localises to the Golgi complex"
  • Microscopy type: Live light, Fixed light
  • Microscopy method: GFP tag, antibody
  • Strain: 3D7
  • Gene model mapping comments: blast from primer GCGCGGTACCATGTATAGAATTCTTAGGATATCAG, annotation matches
  • Localisation record: Golgi complex during ring and trophozoite and schizont and free merozoite
  • Other genes localised in this publication: golgi re-assembly stacking protein 1



Part of OrthoMCL group OG4_11551

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms

Amino Acid Sequence

>PF10_0168-a golgi re-assembly stacking protein 2

Gene-Specific Links for PF10_0168-a

General Sub-Cellular Localisation Links