ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PBANKA_130070 (LAP2, CCp1)

LCCL domain-containing protein, a gene from Plasmodium berghei

Compiled localisation
cytoplasm during gametocyte
crystalloid during ookinete
during not mature oocyst and not midgut sporozoite and not salivary gland sporozoite

Who localised this protein by microscopy?

Saeed, S., Carter, V., Tremp, A. Z., Dessens, J. T.
Plasmodium berghei crystalloids contain multiple LCCL proteins. (2010 Mar, Mol Biochem Parasitol) PubMed / full text
   more detail about this publication

cytoplasm during gametocyte, crystalloid during ookinete, during not mature oocyst and not midgut sporozoite and not salivary gland sporozoite
  • "In ookinetes, on the other hand, the typical distribution of PbLAP2 and PbLAP3 was confined to two focal spots, often visibly associated with clusters of malaria pigment (Fig. 2B)."
  • Microscopy type: Light
  • Microscopy method: GFP tag
  • Strain:
  • Gene model mapping comments: blast from primer ACGAAGTTATCAGTCGACATGAGTCATTACTAGACATAATTACAAGTGAA, annotation doesn't match
  • Localisation record: somewhat punctate cytoplasm during gametocyte, crystalloid during ookinete, not during mature oocyst and midgut sporozoite and salivary gland sporozoite
  • Comment: strain information not found
  • Other genes localised in this publication: LCCL domain-containing protein
  • "Indeed, the presence of PbLAP2 and PbLAP3 in crystalloids was confirmed by immunogold EM experiments (Fig. 2D) carried out as previously described (7)."
  • Microscopy type: EM
  • Microscopy method: GFP tag
  • Strain:
  • Gene model mapping comments: inferred from another publication
  • Localisation record: crystalloid during ookinete
  • Comment: strain information not found
  • Other genes localised in this publication: LCCL domain-containing protein



This gene does not have an OrthoMCL group.

Amino Acid Sequence

>PBANKA_130070 LCCL domain-containing protein


Found in:

Not found in:

Gene-Specific Links for PBANKA_130070

General Sub-Cellular Localisation Links