ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PBANKA_081300 (ICP)

inhibitor of cysteine proteases, a gene from Plasmodium berghei

Compiled localisation
gliding trail during salivary gland sporozoite
vesicles during salivary gland sporozoite
apical and microneme during sporozoites in the presence of host hepatocytes
host cell cytoplasm during after sporozoite invasion of hepatocyte and liver trophozoite
parasitophorous vacuole during cytomere and liver schizont and liver trophozoite
cytosol and not host cell cytoplasm during cytomere and liver schizont
hepatocyte cytoplasm during after liver stage completion of daughter parasite development

Who localised this protein by microscopy?

Rennenberg, A., Lehmann, C., Heitmann, A., Witt, T., Hansen, G., Nagarajan, K., Deschermeier, C., Turk, V., Hilgenfeld, R., Heussler, V. T.
Exoerythrocytic Plasmodium parasites secrete a cysteine protease inhibitor involved in sporozoite invasion and capable of blocking cell death of host hepatocytes. (2010 Mar, PLoS Pathog) PubMed / full text
   more detail about this publication

gliding trail during salivary gland sporozoite, vesicles during salivary gland sporozoite, apical and microneme during sporozoites in the presence of host hepatocytes, host cell cytoplasm during after sporozoite invasion of hepatocyte and liver trophozoite, parasitophorous vacuole during cytomere and liver schizont and liver trophozoite, cytosol and not host cell cytoplasm during cytomere and liver schizont, hepatocyte cytoplasm during after liver stage completion of daughter parasite development
  • "Like the shedded surface protein CSP, PbICP was detected in a patchy pattern in the trails of the circling sporozoites. In addition, staining of unfixed sporozoites with an anti-PbICP-C antiserum confirmed the localization at the apical pole of the sporozoites (Figure S5). Following invasion of hepatocytes, intracellular parasites continue secreting PbICP, which was detected in the host cell cytoplasm (Figure 4A,B, Figure S6, Figure S7). The PVM of early schizont stages can be stained with an antiserum against the PVM-marker protein Exp1 of P. berghei. PbICP co-localized partly with Exp1 but was additionally clearly seen outside of the ring-shaped Exp1 staining, strongly suggesting that the inhibitor is in contact with the host cell cytoplasm (Figure 4C). In later schizont and cytomere stages, PbICP localized mainly to the PV (Figure 4D, E, Figure S4B, Figure S8, Figure S9), but was also found in the parasite cytosol. For these stages we could not detect PbICP in the host cytoplasm."
  • Microscopy type: Light
  • Microscopy method: polyclonal antibody to C terminal domain
  • Strain: ANKA
  • Gene model mapping comments: taken directly from paper, blast from primers GGGAATTCGAAGATAACGACATATACTCTTTTGATATC and CCCAAGCTTTTATTGGACAGTCACGTATATAAT
  • Localisation record: patchy trail and vesicles during salivary gland sporozoites, apical during sporozoites in the presence of host hepatocytes, host cell cytoplasm during after sporozoite invasion
  • Other genes localised in this publication: circumsporozoite (CS) protein, thrombospondin-related anonymous protein, circumsporozoite-related antigen
  • "In permeabilized sporozoites, PbICP staining showed a patchy pattern suggesting a localization in secretory vesicles, which was confirmed by IEM (Figure 2B). Thus, we conclude that at least a portion of PbICP is translocated to the micronemes. ... After completion of daughter parasite development, the PVM starts to disintegrate and this clearly correlates with marked PbICP release into the hepatocyte cytoplasm"
  • Microscopy type: EM
  • Microscopy method: polyclonal antibody
  • Strain: ANKA
  • Gene model mapping comments: inferred from another publication
  • Localisation record: vesicles during salivary gland sporozoites, microneme during sporozoites in the presence of host hepatocytes, PV and host cell cytoplasm during liver trophozoite, PV and parasite cytosol and not host cell cytoplasm during liver schizont and cytomere, hepatocyte cytoplasm during after liver stage completion of daughter parasite development
  • Other genes localised in this publication: circumsporozoite (CS) protein, thrombospondin-related anonymous protein, circumsporozoite-related antigen



Part of OrthoMCL group OG4_41414

Localised Genes in this Group
Other Apicomplexan Genes in this Group
Non-Apicomplexan Genes in this OrthoMCL Group with Gene Ontology 'Inferred from Direct Assay (IDA)' Cellular Component Terms
    There are no non-apicomplexan genes that have manually annotated evidence codes.

Amino Acid Sequence

>PBANKA_081300 inhibitor of cysteine proteases


Found in:

Not found in:

Gene-Specific Links for PBANKA_081300

General Sub-Cellular Localisation Links