ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PBANKA_030510 (SERA1)

serine repeat antigen 1, a gene from Plasmodium berghei

Compiled localisation
parasitophorous vacuole during cytomere and late hepatic and mid hepatic
cytoplasm during cytomere
during mosquito stages and not early blood stages and not early hepatic and not merozome
only parasitophorous vacuole membrane during cytomere and late hepatic and merozome

Who localised this protein by microscopy?

Putrianti, E. D., Schmidt-Christensen, A., Arnold, I., Heussler, V. T., Matuschewski, K., Silvie, O.
The Plasmodium serine-type SERA proteases display distinct expression patterns and non-essential in vivo roles during life cycle progression of the malaria parasite. (2010 Jun, Cell Microbiol) PubMed / full text
   more detail about this publication

during mosquito stages and not early blood stages and not early hepatic and not merozome, parasitophorous vacuole during late hepatic and mid hepatic, only parasitophorous vacuole membrane during cytomere and late hepatic and merozome
  • "Similarly to SERA5 in P. falciparum (Delplace et al., 1987), both PbSERA1/mCherry and PbSERA2/mCherry were detected in late schizonts, but not in early blood stages (Fig. 3B). ... PbSERA1/mCherry was detected in mid and late liver stages, and localized predominantly to the parasitophorous vacuole (PV), which constitutes the parasite/host interface (Fig. 3C). ... Interestingly, PbSERA1/mCherry was not detected in merosomes, in contrast to PbSERA2/mCherry, which gave a strong signal associated with individual merozoites inside merosomes (Fig. 3E)."
  • Microscopy type: Light
  • Microscopy method: 3' mCherry tag
  • Strain: ANKA
  • Gene model mapping comments: blast from EU917224, inconsistent gene model?
  • Localisation record: not during early blood stages, barely during mosquito stages, PV during mid liver stages and late liver stages, not during early liver stages, not during merozomes
  • Other genes localised in this publication: circumsporozoite-related antigen, serine repeat antigen 2
  • "In late liver stages, staining with anti-SERA1C antibodies was mostly restricted to the PV membrane (PVM), as shown by co-localization with the PVM marker exported protein 1 (EXP1) (Fig. 4A, upper panels)."
  • Microscopy type: Light
  • Microscopy method: antibody to C terminus
  • Strain: ANKA
  • Gene model mapping comments: inferred from another publication
  • Localisation record: only PVM during late liver stages and cytomeres and fully differentiated merozoite-containing parasites
  • Other genes localised in this publication: circumsporozoite-related antigen, serine repeat antigen 2

Schmidt-Christensen, A., Sturm, A., Horstmann, S., Heussler, V. T.
Expression and processing of Plasmodium berghei SERA3 during liver stages. (2008 Aug, Cell Microbiol) PubMed / full text
   more detail about this publication

cytoplasm and parasitophorous vacuole during cytomere
  • "Interestingly, at this stage, PbSERA1 was predominantly detected in the PV, suggesting a different localization of both PbSERA proteins"
  • Microscopy type: Light
  • Microscopy method: antibody
  • Strain: ANKA
  • Gene model mapping comments: blast from primers GACTCGAGTTATCCTTCTCCAGTTGGTTGATG and GTGTGAATTCTTAGATGCAGCCGACACAAG, annotation matches
  • Localisation record: mainly PV and cytoplasm during cytomere
  • Other genes localised in this publication: serine repeat antigen 3



This gene does not have an OrthoMCL group.

Amino Acid Sequence

>PBANKA_030510 serine repeat antigen 1


Found in:

Not found in:

Gene-Specific Links for PBANKA_030510

General Sub-Cellular Localisation Links