ApiLoc - A database of published protein sub-cellular localisation in Apicomplexa

version 3 (curated until May 28, 2011)

PBANKA_030490 (SERA3)

serine repeat antigen 3, a gene from Plasmodium berghei

Compiled localisation
close to parasitophorous vacuole membrane and cytoplasm during cytomere

Who localised this protein by microscopy?

Schmidt-Christensen, A., Sturm, A., Horstmann, S., Heussler, V. T.
Expression and processing of Plasmodium berghei SERA3 during liver stages. (2008 Aug, Cell Microbiol) PubMed / full text
   more detail about this publication

close to parasitophorous vacuole membrane and cytoplasm during cytomere
  • "In cytomere-stage parasites, PbSERA3 localized mainly in the parasite cytoplasm and the PVM, with little protein located in the PV (Fig. 7, upper panel)."
  • Microscopy type: Light
  • Microscopy method: TAP tag
  • Strain: ANKA
  • Gene model mapping comments: blast from GTCTCGAGATGTGGTGAAAATTGAACTCTGAA, not blast from GTGGATCCATGGCACGTCTCTCATCAAT, inconsistent gene model?, there are 5 tandem SERA genes, and SERA1 and SERA3 appear to be next to each other, which seems inconsistent
  • Localisation record: mainly cytoplasm and close to PVM during cytomere
  • Other genes localised in this publication: serine repeat antigen 1



This gene does not have an OrthoMCL group.

Amino Acid Sequence

>PBANKA_030490 serine repeat antigen 3


Found in:

Not found in:

Gene-Specific Links for PBANKA_030490

General Sub-Cellular Localisation Links